Sulforafan nedir? | El Paso, TX Kayropraktik Doktoru
Alex Jimenez, El Paso'nun Şiropraktörü
Umarım çeşitli sağlık, beslenme ve yaralanma ile ilgili konulardaki blog yayınlarımızdan memnun kalmışsınızdır. Bakıma ihtiyaç duyulduğunda sorularınız varsa lütfen bizi aramada tereddüt etmeyin. Ofisi kendim ara. Office 915-850-0900 - Hücre 915-540-8444 Saygılarımızla. J

sülforafan Brokoli, lahana, karnabahar ve Brüksel lahanası gibi turpgil sebzelerde bulunan, organosülfür bileşikleri olan izotiyosiyanat grubu içindeki bir fitokimyasal maddedir. Ayrıca bok choy, lahana, yaka, hardal yeşillikleri ve su teresi bulunabilir. Araştırma çalışmaları, sülforafanın çeşitli kanser türlerini önlemeye yardımcı olabileceğini göstermiştir. Nrf2 üretimini aktif hale getirmeveya nükleer faktör eritroid 2 ile ilişkili faktör, hücrenin oksidanlara cevabını kontrol eden koruyucu antioksidan mekanizmalarını düzenleyen bir transkripsiyon faktörüdür. Aşağıdaki yazının amacı sülforafanın işlevini tanımlamaktır.

soyut

KEAP1-Nrf2-ARE antioksidan sistemi, hücrelerin oksidatif ve ksenobiyotik streslere yanıt verdiği temel bir araçtır. Kükürtlü sebzelerden elde edilen bir elektrofilik izotiyosiyanat olan Sulforafan (SFN), KEAP1-Nrf2-ARE yolunu aktive eder ve kronik oksidatif stresin majör etiyolojik rol oynadığı hastalıkların tedavisinde bir molekül haline gelmiştir. Burada, SFN ile tedavi edilen insan retinal pigment epitelyal (RPE-1) hücrelerin mitokondrilerinin, hem Nrf2 hem de sitoplazmik inhibitörü KEAP1'den bağımsız olarak hiperfüzyona uğradıklarını gösterdik. Mitokondriyal füzyonun, apoptoz sırasında mitokondride gözenek oluşumunu inhibe ederek sitoprotektif olduğu ve bununla uyumlu olarak, apoptozis indükleyicisi, staurosporine maruz bırakılan SFN ile tedavi edilen hücrelerin Nrf2-bağımsız, sitoproteksiyonunu gösterdik. Mekanik olarak, SFN, çözünebilir fisyon faktörü Drp1'in mitokondri ve peroksizomlara alınmasını ve / veya tutulmasını azaltmakta ancak genel Drp1 bolluğunu etkilememektedir. Bu veriler, SFN'nin yararlı özelliklerinin, KEAP1-Nrf2-ARE sisteminin aktivasyonunun ötesine uzandığını ve bu ajanın mevcut kullanımının çoklu klinik çalışmalarda kullanılması halinde daha fazla sorgulamayı gerektirdiğini göstermektedir.

Anahtar Kelimeler: Sulforafan, Nrf2, Drp1, Mitokondri, Fisyon, Füzyon, Apoptoz

Giriş

Sulforafan, Mitokondriyal Fisyonun bir Nrf2 Bağımsız İnhibitörüdür.

Sulforafan (SFN), en yaygın olarak turpgillerden elde edilen sebzelerden [56] elde edilen bir izotiyosiyanat bileşiğidir. Hidrolitik enzim miyrosinazının hasarlı hücrelerden vesiküler serbest bırakılması yoluyla predasyona bir ksenobiyotik yanıt olarak bitkilerde üretilir; Bu enzim, glukozinolatları izotiyosirlere [42] dönüştürür. Son yirmi yıldır, SFN, bildirilen antikanser, antioksidan ve antimikrobiyal özellikleri ile geniş ölçüde karakterize edilmiştir [57]. Bu etkinliğin çoğu, KEAP1-Nrf2-antioksidan tepki elementi (ARE) sinyal yolunu modüle etmek için SFN'nin kapasitesine bağlanmıştır, ancak histon deasetilaz aktivitesinin ve hücre döngüsü ilerlemesinin inhibisyonu dahil olmak üzere bileşiğin ilave aktiviteleri tanımlanmıştır [ 29]. Nrf2, ana antioksidan transkripsiyon faktörüdür ve homeostaz koşulları altında, stabilitesi sitoplazmik Cullin3KEAP1 ubiquitin ligaz kompleksinin [20] etkisi ile baskılanır. Spesifik olarak Nrf2, KEAP3 dimerik substrat adaptörüne bağlanarak Cullin1KEAP1 ligazına eklenir ve daha sonra proteazom aracılı bozulma için transkripsiyon faktörünü hedefleyen polyUb zincirleri ile modifiye edilir. Bu yapısal dönüşüm, sıkıştırılmamış hücrelerdeki Nrf2'in yarı ömrünü ~ 15 min [30], [33], [46], [55] olarak sınırlar. stres çeşitli türleri, özellikle oksidatif stres, KEAP1, bir sistein bakımından zengin bir protein, bir redoks sensörü olarak hareket eder ve kritik sistein, özellikle de C151 oksidatif modifikasyonuna cevap olarak, KEAP1 dolayısıyla Nrf2 bozunma [önlenmesi CUL1 gelen Nrf3-KEAP2 ayrışarak 8], [20], [55]. Özellikle, SFN ve muhtemelen diğer Nrf2 aktivatörleri [151] KEAP1 örneğin C21 değiştirerek taklit oksidatif. Nrf2'in stabilizasyonu, Faz II antioksidan ve detoksifikasyon genlerinin bir pilinin ekspresyonunu indüklediği nükleusa translokasyonunu sağlar. Nrf2 küçük Maf proteinleri [19] ile heterodimerizasyonu aracılığıyla aynı kökenli hedef genlerin antioksidan yanıt promotör elemanları (ARE) bağlanır. Bu sistem, SFN gibi dolaylı antioksidanlar için dinamik ve hassas tepkisini gösterir, mitokondri [16] veya oksidatif stres [41] diğer fizyolojik kaynakları tarafından üretilen serbest radikaller.

Mitokondri, ATP üretimi ve hücre içi kalsiyum tamponu ile redoks regülasyonu ve apoptoz [13], [49] arasında değişen bir dizi hücresel işlevi düzenleyen dinamik, hücre içi organellerdir. Mitokondri, hücre içindeki reaktif oksijen türlerinin (ROS) temel kaynağını da temsil eder. Dolayısıyla, aşırı serbest radikal üretiminin potansiyel olarak zararlı etkilerini en aza indirirken, hücresel ihtiyaçları karşılamak için ATP üretiminin optimize edilmesi için mitokondriyal fonksiyonun uygun şekilde düzenlenmesi gereklidir. Mitokondriyal fonksiyonun ince modülasyonu için kritik bir gereklilik, mitokondrinin hem biyokimyasal makineler hem de geniş ve duyarlı bir ağın parçası olarak bağımsız olarak çalışabilme kapasitesidir.

Mitokondriyal ağ morfolojisi ve fonksiyonu, fisyon ve füzyon arasındaki düzenlenmiş bir denge ile belirlenir. Mitokondriyal hücre bölünmesi sırasında hücre bölünmesi [28] 'in hücre hücre mirasına ait mitokondriyal hücre bölünmesi, ayrıca depolarize veya hasarlı mitokondrinin mitokondri (1) olarak adlandırılan seçici, otofajik degradasyonu için gereklidir. Tersine, mitokondriyal genomların tamamlanması ve komşu mitokondriya [54] arasındaki elektron transport zinciri bileşenlerinin paylaşılması için füzyon gereklidir. Moleküler düzeyde, mitokondriyal fizyon ve füzyon büyük, dinamin benzeri GTPazlar tarafından düzenlenir. Üç enzimleri esas olarak füzyon düzenleyen: Mitofusins ​​1 ve 2 (Mfn1 / 2) bitişik mitokondri [15] arasında heterotipik etkileşimler yoluyla dış zar füzyonunu aracılık dış zar proteinleri [25], [37], iki geçiş vardır, OPA1 bir iç iken Aynı zamanda, iç zarların [5] eritilmesini düzenleyerek matriks bağlanmasını sağlayan membran proteini. Üç proteinin her birinin GTPaz aktivitesi, güçlü füzyon [5], [18] için gereklidir ve OPA1, proteazlar OMA1 [14], PARL [6] ve YME1L [45 tarafından mitokondriyal iç zar içindeki kompleks proteoliz ile daha da düzenlenir. ]. Önemli olarak, hasarlı ve sağlıklı mitokondriya [26] entegrasyonunu baskılamak için etkin füzyon için intakt mitokondriyal membran potansiyeli gereklidir.

Mitokondriyal fizyon esas olarak Dynamin ile ilişkili protein 1 (Drp1 / DNM1L) adı verilen bir sitosolik protein tarafından katalize edilir. Drp1, sitozolden mitokondriyal dış membran [43] üzerindeki potansiyel fizyon bölgelerine eklenir. Dış zar üzerindeki Drp1 için başlıca reseptörler mitokondriyal fisyon faktörü (Mff) [32] ve daha az bir ölçüde Fisyon 1 (Fis1) [51] 'dir. Ek olarak, potansiyel fisyon alanlarında [1], Drp51 proteininin aktivitesini daha da sınırlamak için etki eden bir MİSF1 / MiD58 adlı bir çukur reseptör keşfedilmiştir. Bir kez mitokondriyal dış membrana kenetlenen Drp1, mitokondriyonun gövdesi etrafında spiral benzeri yapılara oligomerize olur ve daha sonra, mitokondriyal dış ve iç zarların [17] fiziksel olarak yayılmasına aracılık etmek için GTP hidrolizinden elde edilen enerjiyi kullanır. Endoplazmik retikulum türevli tübüller, Drp1 oligomerizasyonundan önce mitokondrilerin başlangıç ​​küçültücü görevi görürler; bu da, dar olmayan mitokondrilerin tamamlanmış bir Drp1 spiralinin [12] izin veren çevresinden daha geniş olduğunu açığa çıkarır. Aktin dinamiği, mitokondriyal fizyondan (24) önce gelen ER-mitokondri etkileşimleri için de önemlidir. Mitokondriyal fizyondaki rolüne ek olarak, Drp1 peroksizomların [40] fizyonunu katalize eder.

Drp1, her iki proteinin de bir N-terminal GTPaz alanı, kendi kendine oligomerizasyon için kritik olan bir Orta alan ve bir C-terminali GTPaz efektör alanı [31] içerdiği iyi karakterli dinamin proteinine çok benzemektedir. Drp1, reseptör proteinleri Mff ve Fis1 ile etkileşimlerinin bir kombinasyonu ve aynı zamanda DrP1 [2] 'un eşsiz B-insert alanı aracılığıyla mitokondriye özgü fosfolipid kardiyolipine olan yakınlığı aracılığıyla mitokondriyal membranlar için seçicilik sağlar. Drp1 tipik olarak sitoplazmada bir homotetrameri olarak bulunur ve mitokondriyal fizyon sahalarında daha yüksek mertebeden bir düzeneğe, Drp1 [3] 'ın Orta alanı aracılık eder.

Mitokondriyal fonksiyon ile KEAP1-Nrf2-ARE yolu arasındaki örtülü bağlantı göz önüne alındığında, Nrf2 aktivasyonunun mitokondriyal yapı ve fonksiyon üzerindeki etkilerini araştırdık. Burada SFN'nin, beklenmedik bir şekilde, hem Nrf2 hem de KEAP1'den bağımsız olduğu mitokondriyal hiperfüzyonu indüklediğini gösteriyoruz. SFN'nin bu etkisi, Drp1 fonksiyonunun bir inhibisyonudur. Ayrıca SFN'nin, Nrf2'ten bağımsız apoptosise direnç sağladığını ve Drp1'den yoksun hücrelerde gözlenen taklitleri ortaya koyduğunu göstermekteyiz. Bu veriler topluca, Nrf2'i stabilize etmenin ve aktive etmenin yanı sıra, SFN'nin mitokondriyal dinamikleri modüle ettiğini ve hücresel zindeliği ve hayatta kalmayı koruduğunu göstermektedir.

Sonuçlar

Sulforafan, Nrf2 / KEAP1-M Bağımsız Bağımsız Hiperfüzyonunu Etkileritochondria

Nrf2 aktivasyonunun mitokondriyal ağ dinamiği üzerindeki etkilerini incelerken, ölümsüzleştirilmiş, insan retinal pigment epitelyal (RPE-1) hücrelerinin, güçlü bir Nrf2 sinyalizasyon aktivatörü olan sülforafan (SFN) ile tedavisinin sağlam bir füzyona yol açtığını keşfettik. araçla tedavi edilen kontrol hücreleri ile karşılaştırıldığında mitokondriyal ağ (Şekil 1A ve B). Bu hücrelerdeki mitokondrinin morfolojisi, temel mitokondriyal fisyon faktörü (Şekil 1A) olan endojen Drp1'in siRNA'sı tarafından tüketilen hücrelerdeki mitokondrilerinkiyle büyük ölçüde benzeşmiştir. Bu sonuç, mitokondriyal fizyon ve füzyon durumunun, hücrede Nrf2 seviyelerine doğrudan yanıt verdiği konusunda ilginç bir fikir ortaya koymuştur. Bununla birlikte, diğer Nrf2 stabilizatörleri ve proteazom inhibitörü MG132, pro-oksidan tBHQ gibi aktivatörlerle veya Nrf2 inhibitörü KEAP1'in nakavt ile hücrelerin uyarılması, mitokondriyal füzyonu indüklememiştir (Şekil 1A ve B). Nrf2'in bu manipulasyonlarla stabilizasyonu, endojen Nrf2 için western blotting ile doğrulanmıştır (Şekil 1C). Ayrıca, SFN-kaynaklı mitokondriyal füzyon için Nrf2 ekspresyonu, siRNA ile endojen Nrf2'in demonte edilmesi bu fenotipe karşı koyamadığından (Şekil 1D-F). SFN KEAP1 [2] kovalent modifiye sistein kalıntıları ile KEAP1-Nrf21-ARE yolu teşvik için, biz SFN kaynaklı mitokondrial hiperfüzyon bir KEAP1 bağımlı vasıtasıyla uyarıldığında olup olmadığını ele KEAP1 devrilen, ancak Nrf2 bağımsız yolağı. Bununla birlikte, KEAP1'in tükenmesi de SFN'nin neden olduğu mitokondriyal füzyonu ortadan kaldırmamıştır (Şekil 1G-I). Aslında, SFN KEAP1'in tükenmesiyle indüklenen pro-fisyon morfolojisini tersine çevirdi (Şekil 1G, panel b'ye karşı panel d). Bu sonuçlar SFN tedavisinin kanonik KEAP1-Nrf2-ARE yolundan bağımsız olarak mitokondriyal füzyona neden olduğunu ve SFN'nin mitokondriyal fisyon veya füzyon mekanizmasının bileşenlerini doğrudan etkileyip etkilemediğini sorgulamaya itti.

Şekil 1 SFN, Nrf2 / KEAP1 bağımsız mitokondriyal füzyonu indükler. (A) RPE-1 hücreleri, belirtilen siRNA'lar ve 3 günler ile transfekte edilmiş, daha sonra 2 h için DMSO veya Nrf50 aktivatörleri SFN (132 μM), MG10 (100 μM) veya tBHQ (4 μM) ile muamele edilmiştir. Mitokondri (kırmızı) bir anti-Tom20 antikoru ile etiketlenir ve çekirdek (mavi) DAPI ile zıt edilir. (B) (A) 'dan gelen mitokondriyal morfoloji puanlamasını gösteren grafik. > Koşul başına 50 hücreleri kör bir şekilde değerlendirildi. (C) Temsilcisi batı lekeleri (A). (D) RPE-1 hücreleri 10 nM siRNA ve 3 günler ile transfekte edilmiş ve daha sonra (A) 'da olduğu gibi sabitlenmeden ve boyanmadan önce 4 h için SFN ile muamele edilmiştir. (E) (D) 'dan mitokondriyal fenotip puanlamalarının miktarını gösteren grafik. > Koşul başına 100 hücreleri kör bir şekilde değerlendirildi. (F) Temsilci batı lekeleri (D). (G) Hücreler transfekte edildi ve siCON veya siKEAP1 ile (D) 'de olduğu gibi muamele edildi. (H) (G) 'den gelen hücreler mitokondriyal morfoloji temelinde (B) ve (E)' de olduğu gibi puanlanmıştır. (I) Temsilci batı lekeleri (G). (B), (E) ve (H) 'deki veriler, her biri 3 bağımsız deneyinden derlenmiş ve istatistiksel olarak iki kuyruklu Öğrenci t-testi ile belirlendi. Hata çubukları +/- SD'yi yansıtır (Bu şekil efsanesindeki renk referanslarının yorumlanması için okuyucu, bu makalenin web versiyonuna yönlendirilir).

Sulforaphane Drp1'in Mitokondriyal Derneği'ni İşliyor

SFN tedavisinin mitokondriyal hiperfüzyona yol açtığı bulgusuna dayanarak, bu fenotipin ya aşırı füzyon aktivitesinin bir sonucu olduğunu ya da fisyon aktivitesinin bir inhibisyonu olduğunu düşünüyoruz. Bu iki olasılık arasında ayrım yapmak için SFN'nin varlığında ve yokluğunda peroksizomların morfolojisini karşılaştırdık. Peroksizomlar mitokondriye benzerler ve şekilleri sürekli olarak akı (44) olan dinamik organellerdir. Peroksizomlar, dış membranlarında hem Fis1 hem de Mff içerir ve sonuç olarak, Drp1 aracılı fisyon [22], [23] için hedeflerdir. Bununla birlikte, peroksizomlar mitokondriyal ağın füzyon makinesini kullanmaz ve sonuç olarak füzyona uğramamaktadır [39]. Daha ziyade, peroksizomal fizyon, membranların ve proteinlerin de novo ilavesiyle mevcut peroksizomların uzaması ile karşı karşıyadır [44]. Peroksizomlar Mfn1 / 2 ve OPA1 içermediğinden, SFN füzyon makinelerini engellemekten ziyade füzyon mekanizmasını aktive ederse peroksizom uzunluğunun etkilenmeyeceğine karar verdik. Araçla tedavi edilen hücrelerde, peroksizomlar, kısa, yuvarlak, punctiform organeller olarak muhafaza edilir (Şekil 2, paneller b ve d). Bununla birlikte SFN tedavisi, kontrol hücrelerine kıyasla peroksizom uzunluğunu ~ 2-kat artırdı (Şekil 2, f ve h panelleri). Ayrıca, peroksizomların birçoğu, merkeze yakın bir şekilde sıkıştırarak potansiyel bir bozulma bozukluğuna işaret etti (Şekil 2, panel h, ok uçları). Benzer şekilde, Drp1 siRNA ile transfekte edilen hücrelerdeki peroksizomlar, peroksizomal fisyon için Drp2'in gerekli olduğunu doğrulayan ve fizyon mekanizmasını bozarak SFN-tedavisinin mitokondriyal ve peroksizomal fenotiplere neden olduğunu gösteren anormal uzun (Şekil 1, j ve l panelleri) idi.

Şekil 2 SFN, peroksizomal uzatma uyarır. (A) RPE-1 hücreleri, belirtilen siRNA ve 10 günlerinin 3 nM'si ile transfekte edilmiş, daha sonra 50 h için DMSO veya 4 μM SFN ile muamele edilmiştir. Peroksizomlar (yeşil), bir anti-PMP70 antikoru ile etiketlenmiştir, Mitotracker (kırmızı) ve DNA ile mitokondri DAPI ile zıt boyama yapılmıştır. SFN ve Drp1 tükenmesi ile indüklenen morfolojideki değişikliklerin görselleştirilmesini kolaylaştırmak için, sağda peroksizomlar genişletilmiş iç kısımları (d, h ve l panelleri) gösterilmiştir. Ok uçları daralma noktalarını vurgular. (Bu şekil efsanesindeki renk referanslarının yorumlanması için, okuyucu bu makalenin web versiyonuna yönlendirilir).

Daha sonra SFN'nin Drp1 işlevini nasıl kısıtladığını belirledik. Olasılıklar ekspresyon seviyelerinde azalma, mitokondride işe alım / tutma, oligomerizasyon veya GTPaz enzim aktivitesini içermiştir. Bunlardan herhangi birindeki eksiklik mitokondriyal fizyon ve hiperfüzyona neden olur. SFN-tedavisinden sonra Drp1 protein seviyelerinde tekrarlanabilir değişiklikleri saptamadık (Şekil 1C ve 3A).), ve bu nedenle SFN'nin Drp1 ile tutarlı bir şekilde ya da 1 h [10] 'un yarılanma ömrüne sahip olan ve SFN tedavilerimizin daha kısa sürdüğü Drp50 stabilitesini veya ekspresyonunu değiştirmediği sonucuna varılmıştır. Daha sonra, SFN'nin DrP1'in mitokondriye alınmasını veya tutulmasını etkileyip etkilemediğini araştırdık. Fraksiyonasyon çalışmaları, SFN'nin mitokondriyal fraksiyondan (Şekil 1A, şerit 3-7 ve Şekil 8B) bir Drp3 kaybına neden olduğunu göstermiştir. Daha önce bildirildiği gibi [43], sadece küçük bir Drp1 (~ 3%) fraksiyonu, herhangi bir zamanda, herhangi bir zamanda mitokondriyal ağ ile ilişkilidir. denge durumu sitoplazmada bulunan enzimin çoğunun bulunduğu koşullar (Şekil 3A, şerit 5 – 8). Bu fraksiyonasyon verileri, SFN-muamelesinden sonra mitokondriya lokalize, puncttate Drp40 odaklarında% 1 azalma gösteren ortak lokalizasyon analizi kullanılarak doğrulanmıştır (Şekil 3C ve D). Bununla birlikte bu veriler SFN tarafından mitokondriyal füzyon bağlı mitokondrilerin ile Drp1 zayıflatılmış birlikte, en azından kısmen, olduğunu göstermektedir. Verilerimiz, SFN'nin mitokondriyal retansiyona karşı Drp1'in mitokondriyal retansiyonu ile mi, yoksa her ikisinin de mi, yoksa her ikisinin, endojen Drp1'in analizinin GTPaz'ı canlı hücre mikroskopisi ile görselleştirmeye uygun olmadığı arasında ayrım yapmaz.

Şekil 3 SFN, mitokondriden Drp1 kaybına neden olur. (A) 1 h DMSO veya SFN'yi takiben RPE-4 hücrelerinin hücre içi fraksiyonlanması. Tam hücre lizatları (WCL), nükleer (Nuc), sitosolik (Sito) ve ham mitokondriyal (Mito) fraksiyonları SDS-PAGE ile çözülmüş ve belirtilen antikorlarla western blot işlemi için işlenmiştir. Moleküler ağırlık markörlerinin göçü solda gösterilmiştir. (B) (A) 'dan belirtilen fraksiyonlarda Drp1'in dansitometrik kantifikasyonunu gösteren grafikler. (C) RPE-1 hücreleri 10 nM siCON veya siDrp1 ve 3 günler ile transfekte edilmiş, daha sonra 4 h için DMSO veya SFN ile muamele edilmiştir. Drp1 (yeşil) bir anti-Drp1 antikoru, DAPI MitoTracker (kırmızı) ve çekirdekleri ile mitokondri (mavi) ile görünür hale getirildi. (D) (C) 'den Drp1 ve MitoTracker sinyalinin otomatik eş lokalizasyon analizi. (B) ve (D) 'deki veriler sırasıyla 3 ve 5 bağımsız deneylerinden derlenmiş ve istatistiksel olarak iki kuyruklu Öğrenci t-testi ile belirlendi. Hata çubukları +/- SD'yi yansıtır ve yıldız işaretleri istatistiksel önemi gösterir. (Bu şekil efsanesindeki renk referanslarının yorumlanması için, okuyucu bu makalenin web versiyonuna yönlendirilir).

Sulforaphane, Nrf2'den Bağımsız Staurosportine Bağlı Apoptoza Karşı Koruma Sağlar

Önceki çalışma mitokondriyal fisyon [11] Apoptoz sırasında Bax / Bak tarafından oluşturulan dış mitokondriyal zarın gözenek oluşumuna izin veren olduğunu göstermiştir. Drp1'in apoptozis [11] sırasında mitokondriye seçici olarak eklendiği gösterilmiştir ve bununla uyumlu olarak, [27] işleminin başında parçalanmış mitokondri görülmüştür. Tersine, inhibe mitokondriyal fizyon sitokrom c serbest [53] izin dış zar gözeneklerinin oluşumu engelleyerek apoptozu inhibe ettiği düşünülmektedir. Buna göre, mitokondriyal füzyonu uyarmak staurosporin (STS) [14] dahil olmak üzere bileşiklerin neden olduğu apoptosisin ilerlemesini geciktirir. SFN'nin, RP-1 hücrelerini STS-aracılı apoptozdan koruyup korumadığını ve eğer varsa, bunun Nrf2'i gerektirip gerektirmediğini belirlemek için, poli-kaspapoz polimeraz (PARP) bölünmesini, aktif kaspaz-3 substratını kolayca oluşturmak için bir analiz oluşturduk ve kesin apoptoz belirteci. 1 h için 1 uM STS ile RPE-6 hücrelerinin tedavisi sadece çok mütevazı bir PARP yarılmasına neden olmuştur, ancak bu SFN birlikte-tedavi ile engellenmiştir (örneğin, Şekil 4A, 3'e karşı 4 şeridi). Bu tahlilin sağlamlığını arttırmak için, ayrıca, anti-apoptotik faktörü, Bcl-XL'yi hedefleyen siRNA ile ön-muamele etmek suretiyle hücreleri STS-kaynaklı apoptosise karşı duyarlı hale getirdik. Bu ön-tedavi, Bcl-XL ekspresyonunu azalttı ve belirgin bir şekilde STP'ye maruz bırakılan zamanın bir fonksiyonu olarak belirgin bir şekilde PARP bölünmesini teşvik etti (Şekil 4B, 2 şeridini 4-10 şeridine karşılaştırmak). Önemli olarak, SFN'ye maruz kalan hücrelerde SFN'nin azaltılmış PARP bölünmesi ile 2 h ön işlemden geçirilmesi (Şekil 4C, 3'e karşı 4, 5 ve 6'e karşı şerit 2). Benzer şekilde, CRISPR / Cas9 tarafından Nrf4'den stabil olarak tüketilen hücreler, SFN ön-muamelesi ile STS toksisitesinden (Şekil 11C, 12'e karşı 13 ya da 14 ya da 4 ve Şekil 4D'ye karşı şerit 4) karşı korunmuştur. Bu koruma, her iki PARP klivajı (Şekil 2C ve D) ve hücresel morfoloji (Şekil 9E) kullanılarak hazırlanmıştır. Nrf4 tükenmesinin CRISPR / Cas2 ile etkinliği, western blotlama ile doğrulandı (Şekil 1C, Nrf1 blot). Tahmin edildiği gibi, bir hiper füzyon fenotipini (Şekil 4A) veren, Drp1'in tükenmekte olan hücreleri de, SFN ile inkübe edilen kontrol hücreleri ile karşılaştırıldığında STS'ye yanıt olarak PARP bölünmesini bloke etmiştir (Şekil 2F ve G). Bu bulgular birlikte, SFNNXX'in stabilizasyonundan ve aktivasyonundan bağımsız olarak DrpXNUMX fonksiyonunu kısıtlama kapasitesiyle SFN'nin apoptosise karşı koruma sağlamasıyla tutarlıdır.

Şekil 4 SFN zarar verici etkileri Nrf2 ekspresyon (A), RPE 1 Hücreler, steril DMSO, 50 uM staurosporin ile tedaviye 2 saat DMSO veya 1 uM SFN ile önceden tedavi edilmiştir (STS) veya 50 uM etoposid için bağımsız 6 h ve anti-PARP western blot işlemi için işlendi. (B) RPE-1 hücreleri 2.5 nM siCON, 1 nM siBcl-XL veya 2.5 nM siBcl-XL ile transfekte edildi ve 3 gün sonra 1, 2 veya 4 h için DMSO veya 6 μM STS ile muamele edildi. Temsili batı lekeleri gösterilmiştir ve moleküler ağırlık markörlerinin göçü solda gösterilmiştir. (C), CRISPR / Cas9 oluşturulan vahşi tip (Nrf2WT) ve Nrf2 nakavt (Nrf2KO) RPE 1 hücreleri daha sonra 1 saat DMSO veya 3 uM SFN ile önceden tedavi edilen 50 nM siBcl-XL ve 2 gün ile transfekte edilmiştir. Ardından, hücreler 1, 2 veya 4 h için 6 μM STS ile muamele edildi. Belirtilen antikorlarla temsili batı lekeleri gösterilmiştir. (D) Ayrılmış PARP'ın 3 bağımsız deneylerinden elde edilen toplam PARP'nin (yarılmış + bölünmemiş) yüzdesi olarak kantifikasyonu. Önemli olarak, bölünmüş PARP seviyeleri, hücrelerin Nrf2 eksprese edip etmediği ile karşılaştırılabilir olup, bu da STS'den SFN korumasının transkripsiyon faktöründen bağımsız olduğunu göstermektedir. (E) 20X faz-kontrast görüntüleri lizatların (C) 'den hasat edilmesinden hemen önce alınır. Ölçek çubuğu = 65 µm. (F) Drp1'in tükenmesinin STS'den SFN tedavisi olarak benzer karşılaştırılabileceğini gösteren temsili batı lekeleri. RPE-1 hücreleri 1 nM siBcl-XL ile transfekte edildi ve ek olarak 10 nM siCON veya 10 nM siDrp1 ile transfekte edildi. 3 gün sonra, siCON hücreleri (A) ve (C) 'de olduğu gibi SFN ile ön-muameleye tabi tutuldu ve daha sonra hasat edilmeden önce 4 h için STS'ye maruz bırakıldı ve belirtilen antikorlar ile western blot işlemi için işlendi. (G) 3 bağımsız deneylerinden derlenen (F) 'de sunulan veriler için (D) ile aynıdır. Hata çubukları +/- SEM'i yansıtır

Tartışma

SFN'nin, KEAP1-Nrf2-ARE yolu üzerindeki etkilerinden bağımsız olarak mitokondriyal fisyon / füzyon dinamiklerini modüle ettiğini keşfettik. Bu, mitokondriyal disfonksiyon ve ROS üretimi ile Nrf2 aktivasyonu yoluyla mitokondriden türetilmiş serbest radikallerin karışma zorunluluğu arasındaki varsayılan bağlantı nedeniyle ilgi çekicidir. SFN'nin bu ek fonksiyonel etkisi, prostat kanseri, obstrüktif akciğer hastalığı ve orak hücre hastalığı [30], [7], [dahil olmak üzere çeşitli hastalıkların tedavisi için SFN'nin şu anda devam eden 10 klinik çalışmalarından daha fazla olması nedeniyle potansiyel bir öneme sahiptir. 47].

SFN bir izotiyosiyanat [56] ve doğrudan Nrf2 bozunmasını [1] bastırmak için kritik KEAP2 sistein asillenmesiyle Nrf21 sinyal aktive olduğundan, SFN sistein modifikasyonu aracılığı ile fizyon veya füzyon faktörünün aktivitesinin modüle edilmesi suretiyle pro-füzyon etkiler yarattığı da aşağıdaki . Verilerimiz, GTPaz'ın doğrudan asilasyon hedefi olup olmadığına bakılmaksızın, DrP1'in SFN tarafından negatif olarak düzenlenmesini kuvvetle desteklemektedir. Bu bilgi boşluğuna rağmen, hem mitokondri hem de peroksizomlar gibi, Drp1'in işlevi açıkça SFN tarafından tehlikeye atılmaktadır. hyperfused SFN tedavisine yanıt olarak ve bu organeller, ilgili scizyon olayları için Drp1'i paylaşmaktadır [38]. Ayrıca SFN, mitokondriyalde yerleşen ve biriktiren Drp1 miktarını azaltır (Şekil 3). Deneylerimiz tüm endojen proteinler ile yapıldığı için, mitokondriyal fizyon bölgelerindeki Drp1 tespitimiz kararlı durum koşulları altındadır ve sonuç olarak, bir işe alım ile SFN'nin neden olduğu enzimin bir tutma kusuru arasındaki farkı ayırt edemeyiz. Ayrıca, SFN'nin DrP1 işe alımını engellemek için mitokondriyada (Fis1 veya Mff) bir reseptörü açtığı olasılığını ortadan kaldıramayız, Drp1'in doğrudan modifiye edildiğinden şüpheleniyoruz. Drp1'in dokuzu, Oligomerizasyon için gereken [3] ve biri Drp1'in C-terminusunda GTPaz Efektör Alanı'nda (GED) bulunan, Orta Etki Alanı içinde yer alan dokuz sistein içerir. Bu sisteinlerden herhangi birinin doğrudan asilasyonu, Drp1'te bir aktivite bozukluğuna neden olabilir ve bu nedenle SFN'nin mitokondriyal dinamizm üzerindeki etkisinin altında yatan neden olabilir. Özellikle, önceki çalışmalar oligomerizasyon ve katalitik aktivitedeki kusurların, DrP1'in mitokondriya [52] 'de tutulmasını ortadan kaldırabileceğini düşündürmektedir. GED alanındaki Cys644, önceki çalışmalara dayanan, özellikle de bu sistein fenokopileri mutasyonlarının, Drp1 GTPaz aktivitesini [4] bozan ve bu özel sisteinin tiyol-reaktif elektrofiller [9] tarafından modifiye edildiğini gösteren, özellikle çekici bir hedeftir. Bu olağanüstü sorunun çözümü, kütle spektrometrisi doğrulama gerektirecektir..İçinde Özetle, klinik olarak ilgili bileşik SFN için bir yeni, sitoprotektif fonksiyon tanımladık. Master anti-oksidan transkripsiyon faktörü Nrf2'in aktive edilmesine ek olarak, SFN mitokondriyal ve peroksizomal füzyonu teşvik eder ve bu etki Nrf2'den bağımsızdır. Bu fenomenin altında yatan mekanizma, mitokondriyal ve peroksizomal fisyonun primer medyatörü olan GTPase Drp1'in fonksiyonunda bir azalmayı içerir. SFN aracılı mitokondriyal füzyonun önemli bir sonucu, hücrelerin apoptosis indükleyicisi staurosporinin toksik etkilerine dirençli hale gelmesidir. SFN'nin bu ek sitoprotektif etkisi, bu hastalıkların apoptoz ile ilişkili olduğu ve azaldığı için yaşın önde gelen risk faktörü (örn. Parkinson Hastalığı, Alzheimer Hastalığı, Yaşa Bağlı Maküler Dejenerasyon) olduğu sayısız nörodejeneratif hastalıklarda özel bir klinik yarar sağlayabilir. Nrf2 [35], [36], [48] seviyelerini ve / veya disregülasyonunu. Birlikte, bu veriler, SFN'nin sitoprotektif özelliklerinin, KEAP1-Nrf2-ARE sisteminin aktivasyonunun ötesine uzandığını ve bu ajanın çoklu klinik denemelerde mevcut kullanımı göz önüne alındığında daha ileri çalışmaları garanti ettiğini göstermektedir..

Malzemeler ve mö n- tem

Apoptoz Tahliller

Hücreler, aşağıda belirtildiği gibi siRNA ile tohumlandı ve transfekte edildi. Hücreler, mitokondriyal füzyonu indüklemek için 50 h için 2 μM sülforafan ile önceden işlendi ve daha sonra apoptoza neden olmak için 1 μM staurosporin ile tedavi edildi. Hasat zamanında, ortam ayrı ayrı tüplerde toplanmış ve pelet apoptotik hücrelere yüksek hızlı santrifüj işlemine tabi tutulmuştur. Bu hücre pelleti, yapışkan hücrelerle birleştirildi ve 2 kez konsantre Laemmli tamponu içinde çözündürüldü. Numuneler, anti-PARP western blotlamaya tabi tutuldu.

CRISPR / Cas9 Konstrüksiyon Üretimi

LentiCRISPR / eCas9 1.1 oluşturmak için, LentiCRISPR v2 (addgene #52961) ilk önce Age1 ve BamH1 ile kesildi. Daha sonra, eSpCas9 9'den (addgene #1.1) SpCas71814, aşağıdaki primerler (İleri AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Ters AAGCGCGGATCCCTTTTTCTTTTTTGCCTGGCCGG) kullanılarak ve yukarıda kesik vektöre bağlanmış olan Age1 ve BamH1 çıkıntıları ile PCR ile amplifiye edildi. sgRNA dizileri Benchling.com kullanılarak belirlendi. Parametreler, kodlama dizisini hedeflenen en yüksek ve en düşük hedef dışı skorlarla hedeflemek için ayarlandı. Tavlanmış ve BsmB2 LentiCRISPR / eCas2 1 kesilmiş lige edilmiştir Aşağıdaki diziler; (; hs sgNFE2L2 # 2 sens CACCGGTTTCTGACTGGATGTGCT antisens AAACAGCACATCCAGTCAGAAACC hs sgNFE2L2 # 3 sens CACCGGAGTAGTTGGCAGATCCAC antisens AAACGTGGATCTGCCAACTACTCC hedef sekans altı çizili, sgNFE1L9 # 1.1 sens CACCGCGACGGAAAGAGTATGAGC antisens AAACGCTCATACTCTTTCCGTCGC hs). Lentiviral olarak enfekte edilmiş RPE-1 hücreleri, puromisin ile seçilmiştir ve havuzlanmış bir popülasyon olarak muhafaza edilmiştir. Nakavt, immünofloresan ve western blotlama ile doğrulandı.

Hücre Kültürü ve Transfeksiyonları

Telomeraz (RPE-1) (ATCC) ile transforme edilen insan retinal pigment epitel hücreleri, penisilin, streptomisin, 1X esansiyel olmayan amino asit kokteyli (Life Technologies) ile takviye edilmiş 1 g / L glikoz içeren Dulbecco Modifiye Eagle Ortamı (DMEM) içinde kültürlendi, ve 10% Fetal Sığır Serumu (Yaşam Teknolojileri). SiRNA-transfeksiyonları için, 30,000-35,000 hücreleri / mL gece boyunca tohumlandı. Hücreler, serumsuz DMEM içinde seyreltilmiş 10 nM siRNA aldı ve 0.3% Interferin transfeksiyon reaktifi (PolyPlus) ile birleştirildi. Apoptoz duyarlılığı için, hücreler 1 nM Bcl-XL siRNA aldı. Hücreler, transfeksiyon sonrası 2-3 gün hasat edildi.

Kimyasallar, Antikorlar ve siRNA Oligos

Α-tubulin (Hücre Sinyalleme), β-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Hücre Sinyalleme), PMP70 (Abcam) ve Tom20 (BD Biosciences) karşı antikorlar ) 1: 1000 dilüsyonlarında western blot ve immünofloresan için kullanıldı. In-house, anti-Nrf2 tavşan antikoru, 1: 2000, western blotting [34], [59] için kullanılmıştır. Sülforafan (Sigma) ve staurosporin (Tocris) sırasıyla 50 μM ve 1 μM'de kullanıldı. Aksi belirtilmediği sürece, 1 nM'de Drp2 (Dharmacon), Nrf1 (Dharmacon), KEAP10 (Hücre Sinyalleme) ve Bcl-XL (Hücre Sinyalleme) karşı siRNA'lar kullanıldı.

İmmünofloresans ve Vivo Etiketleme

18 mm cam lamelleri üzerinde tohumlanan hücreler, araç veya ilaç ile muamele edilmiş, 3.7% formaldehid içinde sabitlenmiş ve daha sonra 0.2 dakika boyunca buz üzerinde 100% Triton X-10 / PBS içinde geçirgen hale getirilmiştir. Birincil antikorlar 3 ° C'de gece boyunca PBS içinde 4% sığır serum albümini (BSA) içinde kuluçkaya yatırıldı. PBS yıkamasını takiben hücreler, 1 h için 488% BSA / PBS içinde türlere uygun, Alexa546- veya Alexa1-, konjuge sekonder antikorlar (seyreltilmiş 1000: 0.1) ve 3 μg / mL DAPI (Sigma) için inkübe edildi. Mitokondri, anti-Tom20 immünofloresans veya 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) içinde 30 ° C'de 37 dakika boyunca serumsuz DMEM içinde hücrelerin inkübe edilmesinden önce tespit edildi.

Mikroskopi ve Görüntü Analizi

İmmünofloresan örnekleri bir LSM710 Konfokal mikroskopta (Carl Zeiss) görülmüştür. Mikrograflar, 63X veya 100X yağlı batırma hedefleri ve Adobe Photoshop CS6 kullanılarak ayarlanan ve geliştirilmiş görüntüler kullanılarak yakalandı. Co-lokalizasyon analizi, Carl Zeiss LSM710 ortak lokalizasyon özelliği kullanılarak numunelerin kimliğine göre körleştirilirken elle ayarlanan eşikler kullanılarak gerçekleştirildi. Aksi belirtilmedikçe, ölçek çubukları 10 µm'dir. Mitokondriyal morfoloji kör puanlama ile değerlendirildi. Bir hücrenin mitokondri, çoklu, yuvarlak, ayrımcı puncta olarak muhafaza edildiğinde, hücre 'fisyon' olarak puanlandı. Bireysel mitokondri ayırt edilemez ve tüm mitokondriyal ağ sürekli gözükse, hücre 'füzyon' olarak puanlandı. Mitokondri kümelenmesi de dahil olmak üzere tüm diğer hücreler, 'ara' olarak puanlandı.

Subselüler Fraksiyonlar

RPE-1 hücreleri konfluansa büyütüldü. Bir PBS yıkamasının ardından, hücreler 600 min için 10 x g'de santrifüj işlemine tabi tutuldu ve 600 μL izolasyon tamponu (210 mM Mannitol, 70 mM Sakaroz, 5 mM MOPS, 1 mM EDTA pH 7.4 + 1 mM PMSF) içinde yeniden süspanse edildi. Süspansiyon bir Dounce homojenizatöründe 30 kez çözüldü. Homojenatın bir fraksiyonu, bir "bütün hücre lizatı" olarak korunmuştur. Geri kalan, 800 min için, pelet çekirdeğine 10 × g'de santrifüj işlemine tabi tutulmuştur. Süpernatantlar 1500 x g'de 10 min için santrifüj işlemine tabi tutuldu ve kalan nükleusları ve reaksiyona girmemiş hücreleri temizlemek için. Bu süpernatant, 15,000 min için pelet mitokondrilerine 15 × g'de santrifüj işlemine tabi tutuldu. Süpernatant “sitosolik fraksiyon” olarak korunmuştur. Pelet, yavaşça PBS ile yıkandı ve izolasyon tamponu içinde yeniden süspanse edildi. Her fraksiyonun protein konsantrasyonu bicinkhoninic asit (BCA) testi ile ölçüldü ve eşdeğer miktarda protein SDS-PAGE ile çözüldü.

Western lekeleme

Hücreler, PBS içinde yıkandı ve 2 ile konsantre edildi. Laemmli çözündürme tamponu (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromofenol mavisi, 2% 2-merkaptoetanol, 26.3% gliserol ve 0.001% Pyrinin Y). Lizatlar, sodyum dodesil sülfat (SDS) poliakrilamid jelleri üzerine yüklenmeden önce 5 dakika boyunca kaynatıldı. Proteinler nitroselüloz zarlarına aktarıldı ve membranlar 1% Süt / TBST'de 5 h için bloke edildi. Birincil antikorlar 5% Süt / TBST içerisinde seyreltildi ve 4 ° C'de gece boyunca blot ile inkübe edildi. Horseradish peroksidaz (HRP) ile konjuge sekonder antikorlar 5% Milk / TBST içerisinde seyreltildi. Lekeler geliştirilmiş kemilüminesans ile işlendi ve ImageJ yazılımı kullanılarak dansitometrik ölçümler yapıldı.

Dr Jimenez Beyaz Coat

Sulforafan, diğerlerinin yanı sıra brokoli, lahana, karnabahar, lahana ve lahana da dahil olmak üzere, turunçgil sebzelerden elde edilen organosülfür maddelerin izotiyosiyanat topluluğundan elde edilen bir kimyasaldır. Sülforafan, enzim miyrosinazın bir glukosinolat olan glukofanamini sülforafan-glukozinolat olarak da bilinen sülforafan haline dönüştürdüğü zaman üretilir. Brokoli lahanası ve karnabahar, en yüksek glukorafanin konsantrasyonuna veya sülforafanın öncülüne sahiptir. Araştırma çalışmaları, sülforakanın çeşitli sağlık sorunlarını önlemek için insan vücudunun antioksidan özelliklerini geliştirdiğini göstermiştir.

Alex Jimenez DC, CCST Insight

Sulforafan ve Kanser, Mortalite, Yaşlanma, Beyin ve Davranış, Kalp Hastalığı ve Daha Fazlası Üzerine Etkileri

İzotiyosiyanatlar, diyetinizde alabileceğiniz en önemli bitki bileşenlerinden bazılarıdır. Bunda video Bugüne kadar yapılmış en kapsamlı davayı ben yapıyorum. Kısa konsantrasyon süresi? Aşağıdaki zaman noktalarından birine tıklayarak favori konuya geçin. Tam aşağıdaki zaman çizelgesi.

Anahtar bölümler:

  • 00: 01: 14 - Kanser ve ölüm oranı
  • 00: 19: 04 - Yaşlanma
  • 00: 26: 30 - Beyin ve davranış
  • 00: 38: 06 - Son tekrar
  • 00: 40: 27 - Doz

Tam zaman çizelgesi:

  • 00: 00: 34 - Sülforafanın tanıtımı, videonun ana odak noktası.
  • 00: 01: 14 - Tüm nedenlere bağlı mortalitede turunç sebze tüketimi ve azalma.
  • 00: 02: 12 - Prostat kanseri riski.
  • 00: 02: 23 - Mesane kanseri riski.
  • 00: 02: 34 - Sigara içenlerde akciğer kanseri riski.
  • 00: 02: 48 - Meme kanseri riski.
  • 00: 03: 13 - Varsayımsal: Eğer zaten kanseriniz varsa? (Girişimsel)
  • 00: 03: 35 - Makul mekanizma sürüyor kanser ve mortalite birleştirici veriler.
  • 00: 04: 38 - Sulforafan ve kanser.
  • 00: 05: 32 - Hayvan kanıtı gösteriliyor güçlü Ratlarda brokoli filiz ekstresinin mesane tümörü gelişimine etkisi.
  • 00: 06: 06 - Prostat kanserli hastalarda sulforafanın direk takviyesinin etkisi.
  • 00: 07: 09 - Gerçek meme dokusunda izotiyosiyanat metabolitlerinin biyoakümülasyonu.
  • 00: 08: 32 - Meme kanseri kök hücrelerinin inhibisyonu.
  • 00: 08: 53 - Tarih dersi: Brassicas, antik Roma'da bile sağlık özelliklerine sahip olarak kuruldu.
  • 00: 09: 16 - Sulforaphane'in karsinojen atılımını (benzen, akrolein) geliştirme kabiliyeti.
  • 00: 09: 51 - NRF2, antioksidan tepki elemanları yoluyla genetik bir anahtar olarak.
  • 00: 10: 10 - NRF2 aktivasyonu, glutatyon-S-konjugatları yoluyla karsinojen atılımını nasıl arttırır.
  • 00: 10: 34 - Brüksel lahanası glutatyon-S-transferazı arttırır ve DNA hasarını azaltır.
  • 00: 11: 20 - Brokoli filiz içeceği, 61% ile benzen atılımını artırır.
  • 00: 13: 31 - Brokoli filiz homojenatı üst solunum yolundaki antioksidan enzimleri arttırır.
  • 00: 15: 45 - Küflü sebze tüketimi ve kalp hastalığı mortalitesi.
  • 00: 16: 55 - Brokoli filiz tozu, 2 tipi şeker hastalarında kan lipitlerini ve genel kalp hastalığı riskini artırır.
  • 00: 19: 04 - Başlangıcı yaşlanma Bölüm.
  • 00: 19: 21 - Sulforaphane zenginleştirilmiş diyet artırır ömür 15'ten 30% 'e kadar olan böceklerin (bazı durumlarda).
  • 00: 20: 34 - Uzun ömürlülük için uzun inflamasyonun önemi.
  • 00: 22: 05 - Küflü sebzeler ve brokoli filiz tozu, insanlarda çok çeşitli inflamatuar belirleyicileri azaltır.
  • 00: 23: 40 - Orta video karması: kanser, yaşlanma bölümleri
  • 00: 24: 14 - Fare çalışmaları sülforafanın yaşlılıkta adaptif immün fonksiyonu geliştirebileceğini düşündürmektedir.
  • 00: 25: 18 - Sulforaphane bir fare modelinde saç uzamasını iyileştirdi. Resim 00: 26: 10.
  • 00: 26: 30 - Beyin ve davranış bölümünün başlangıcı.
  • 00: 27: 18 - Brokoli filiz ekstresinin otizm üzerine etkisi.
  • 00: 27: 48 - Glukobrafaninin şizofreni üzerine etkisi.
  • 00: 28: 17 - Depresyon tartışmasının başlangıcı (makul mekanizma ve çalışmalar).
  • 00: 31: 21 - 10'in stresle indüklenen depresyonun farklı modellerini kullanan fare çalışması, fluoksetin gibi etkili bir şekilde sülforafanı gösterir (prozac).
  • 00: 32: 00 - Çalışma, farelerde glucoraphanin'in doğrudan alınmasının sosyal defeat stres modelinden depresyonun önlenmesinde benzer şekilde etkili olduğunu göstermektedir.
  • 00: 33: 01 - Nörodejenerasyon bölümünün başlangıcı.
  • 00: 33: 30 - Sulforaphane ve Alzheimer hastalığı.
  • 00: 33: 44 - Sulforaphane ve Parkinson hastalığı.
  • 00: 33: 51 - Sulforaphane ve Hungtington hastalığı.
  • 00: 34: 13 - Sulforaphane ısı şoku proteinlerini arttırır.
  • 00: 34: 43 - Travmatik beyin hasarı bölümünün başlangıcı.
  • 00: 35: 01 - TBI, belleği geliştirdikten hemen sonra (fare çalışması) enjekte edilir.
  • 00: 35: 55 - Sulforafan ve nöronal plastisite.
  • 00: 36: 32 - Sulforaphane öğrenmeyi geliştiriyor model farelerde tip II diyabetin.
  • 00: 37: 19 - Sulforaphane ve duchenne kas distrofisi.
  • 00: 37: 44 - Kas uydu hücrelerinde miyostatin inhibisyonu (in vitro).
  • 00: 38: 06 - Geç video tekrarı: mortalite ve kanser, DNA hasarı, oksidatif stres ve inflamasyon, benzen atılımı, kardiyovasküler hastalık, tip II diyabet, beyin üzerindeki etkiler (depresyon, otizm, şizofreni, nörodejenerasyon), NRF2 yolu.
  • 00: 40: 27 - Brokoli filizi veya sülforafan dozunun belirlenmesi üzerine düşünceler.
  • 00: 41: 01 - Evde filizlenme anekdotları.
  • 00: 43: 14 - Pişirme sıcaklıklarında ve sülforafan aktivitesinde.
  • 00: 43: 45 - Sülforafanın glukorafanin'den gut bakteri dönüşümü.
  • 00: 44: 24 - Takviyeler, sebzelerden aktif mirrosinaz ile kombine edildiğinde daha iyi çalışır.
  • 00: 44: 56 - Pişirme teknikleri ve turpgiller sebzeler.
  • 00: 46: 06 - Gootrojenler olarak izotiyosiyanatlar.

Teşekkür

Sciencedirect.com/science/article/pii/S2213231716302750

Sulforafan nasıl üretilir?

Isıtıcı Epithiospecifier Protein Aktivitesini Azaltır ve Brokoli'de Sülforafan Oluşumunu Artırır

soyut

Brokoli'den elde edilen bir izotiyosiyanat olan sülforafan, en güçlü gıda kaynaklı antikarsinogenlerden biridir. Bu bileşik bozulmamış sebzede mevcut değildir, bunun yerine brokoli dokusu ezildiğinde veya çiğnendiğinde bir tiyoglukosidaz enzimi olan mirrosinazın etkisiyle glukosinolat ön maddesinden, glukosfaninden oluşur. Bununla birlikte, bir dizi çalışma glukofanfandan sülforafan veriminin olduğunu göstermiştir. düşük, ve bitki dokusu oda sıcaklığında ezildiğinde, biyoaktif olmayan nitril analog, sülforafan nitril, birincil hidroliz ürünüdür. Son kanıtlar Arabidopsis'te glikozinolatlardan nitril oluşumunun ısıya duyarlı bir protein tarafından kontrol edildiğini göstermektedir. epithiospecifier Protein (ESP), myrosinazın katalitik olmayan bir kofaktörünü içerir. Bizim amacımız, brokolinin ESP aktivitesi içerip içermediğini belirlemek için, brokoli çiçeği ve filizlerinin sülforafan ve sülforafan nitril oluşumu üzerindeki etkilerini incelemek, daha sonra ESP aktivitesinde ısı bağımlı değişimleri, sülforakan içeriğini ve biyoaktiviteyi, hücre kültüründe faz II detoksifikasyon enzim kuinon redüktaz (QR). Homojenizasyondan önce taze brokoli çiçeği veya brokoli filizi 60 ° C'ye ısıtılarak eş zamanlı olarak sülforafan oluşumu ve sülforakan nitril oluşumunun azalması sağlandı. ESP aktivitesinde kayda değer bir azalma, sülforafan nitril oluşumundaki azalmaya paralel olmuştur. 70 ° C ve üzeri ısıtma, brokoli florürlerde her iki ürünün de oluşumunu azaltmıştır, ancak brokoli filizlerinde bulunmamıştır. Kültürlenmiş fare hepatoma Hepa lclc7 hücrelerinde QR indüksiyonu, sülforafan oluşumunda paralel artışlar gösterdi.

Brokoli çiçeği ve filizlerinin 60 ° C'ye ön ısıtılması, ezme işleminden sonra bitkisel doku ekstrelerinde bulunan sülfosfanın (SF) myrosinaz katalizli oluşumunu önemli ölçüde arttırmıştır. Bu, sülforafan nitril (SF Nitril) oluşumu ve epithiospesilatör protein (ESP) aktivitesindeki azalmalar ile ilişkiliydi.

Anahtar Kelimeler: Brokoli, Brassica oleracea, Cruciferae, Kanser, Anticarcinogen, Sulforaphane, Sulforaphane nitril, Epithiospecifier protein, Quinone redüktaz

Sonuç olarak, sülforafan bir fitokimyasal olarak bulunur. Brokoli,ve diğer turpgil sebzeleri. Hem iç hem de dış faktörlerin neden olduğu kontrolsüz miktarda oksidan, insan vücudunda çeşitli sağlık sorunlarına yol açabilecek oksidatif strese neden olabilir. Sülforafan, hücrenin oksidanlara tepkisini kontrol eden koruyucu antioksidan mekanizmalarını düzenlemeye yardımcı olan bir transkripsiyon faktörü olan Nrf2'in üretimini aktive edebilir. Bilgilerinizin kapsamı kayropraktik ve omurilik sağlığı ile sınırlıdır. Konuyu tartışmak için, lütfen Dr. 915-850-0900 .

Alex Jimenez'in küratörlüğü

Referanslananlar: Sciencedirect.com

Yeşil Çağrı Şimdi Düğme H .png

Ek Konu Tartışması: Akut Sırt Ağrısı

sırt ağrısı Dünya çapında en sık görülen özürlülük ve kayıp günlerden birisidir. Dokular ofis ziyaretleri için ikinci en yaygın neden olan sırt ağrısı özellikleri, sadece üst solunum yolu enfeksiyonları tarafından sayıca azdır. Nüfusun yaklaşık yüzde 80'i hayatları boyunca en az bir kez sırt ağrısı çekecek. Omurga diğer yumuşak dokular arasında kemikler, eklemler, bağlar ve kaslardan oluşan karmaşık bir yapıdır. Bu nedenle, yaralanmalar ve / veya ağırlaştırılmış koşullar gibi fıtıklı diskler, sonunda sırt ağrısı belirtileri yol açabilir. Spor yaralanmaları veya otomobil kazası yaralanmaları sıklıkla sırt ağrısının en sık nedenidir, ancak bazen en basit hareketler ağrılı sonuçlara neden olabilir. Neyse ki, kayropraktik bakım gibi alternatif tedavi seçenekleri, omurga düzeltmeleri ve manuel manipülasyonların kullanımıyla ağrıyı hafifletmeye yardımcı olabilir, sonuçta ağrı rahatlamasını iyileştirir.

karikatür kağıt boyu resmi

EKSTRA EKSTRA | ÖNEMLİ KONULAR: Önerilen El Paso, TX Chiropractor

***